This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005781


Marker Name:  MCW0036 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CCTCATGTGAAGCATCTTTTCATA
Primer: TGTCTTCAGTAGGACTGTGATAC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
386.000 386.000 386.000
Consensus 2005 (A): 1 Chicken
chromosome 1
385.000 386.000 387.000
East Lansing (M): 1 Chicken
chromosome 1
328.880 328.880 328.880
Jacobsson et al 2004 (A): 1 Chicken
chromosome 1
344.600 344.600 344.600
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
386.000 386.000 386.000
Wageningen (A): 1 Chicken
chromosome 1
356.500 356.500 356.500
Wageningen (F): 1 Chicken
chromosome 1
334.300 334.300 334.300
Wageningen (M): 1 Chicken
chromosome 1
381.500 381.500 381.500


© The Roslin Institute 2007-2012, all rights reserved