This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005765


Marker Name:  MCW0020 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TCTTCTTTGACATGAATTGGCA
Primer: GCAAGGAAGATTTTGTACAAAATC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003772

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
460.000 460.000 460.000
Consensus 2005 (A): 1 Chicken
chromosome 1
459.000 460.000 461.000
East Lansing (M): 1 Chicken
chromosome 1
429.050 429.050 429.050
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
168695069.000 168695160.000 168695251.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
163756855.000 163756946.500 163757038.000
Wageningen (A): 1 Chicken
chromosome 1
433.500 433.500 433.500
Wageningen (F): 1 Chicken
chromosome 1
419.500 419.500 419.500
Wageningen (M): 1 Chicken
chromosome 1
456.100 456.100 456.100


© The Roslin Institute 2007-2012, all rights reserved