This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005764


Marker Name:  MCW0019 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CCCAGATTGATTTCATCATTCAAG
Primer: GCATCTCCTCTCTACAGCCATGAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G31933
has an Associated Sequence: Local Sequence ID: ARKFSQ00003771

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
67879065.000 67879121.000 67879177.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
65868320.000 65868376.000 65868432.000
Wageningen (A): 1 Chicken
chromosome 1
170.400 170.400 170.400
Wageningen (F): 1 Chicken
chromosome 1
164.100 164.100 164.100
Wageningen (M): 1 Chicken
chromosome 1
180.100 180.100 180.100


© The Roslin Institute 2007-2012, all rights reserved