This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005763


Marker Name:  MCW0018 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GGAATTTGAACACCTGAGATTTCC
Primer: CACTATGTTTATGGCAAACTCCTG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
East Lansing (M): 1 Chicken
chromosome 1
187.780 187.780 187.780
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
154.200 154.200 154.200
Wageningen (A): 1 Chicken
chromosome 1
174.500 174.500 174.500
Wageningen (F): 1 Chicken
chromosome 1
167.200 167.200 167.200
Wageningen (M): 1 Chicken
chromosome 1
184.400 184.400 184.400


© The Roslin Institute 2007-2012, all rights reserved