This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005750


Marker Name:  MCW0010 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CTGTAGAATTACAGAAATACA
Primer: TAGTACAAGAATCTAGTGTTAAAA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003767

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Carlborg, Orjan. et al . 2003 (A): 1 Chicken
chromosome 1
35.300 35.300 35.300
Consensus 2000 (A): 1 Chicken
chromosome 1
72.000 72.000 72.000
Consensus 2005 (A): 1 Chicken
chromosome 1
71.000 72.000 73.000
East Lansing (M): 1 Chicken
chromosome 1
69.600 69.600 69.600
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
25275933.000 25275979.000 25276025.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
23257559.000 23257605.000 23257651.000
Ikeobi, C.O.N. et al . 2004 (A): 1 Chicken
chromosome 1
41.900 41.900 41.900
Kerje et al. 2003a (A): 1 Chicken
chromosome 1
35.300 35.300 35.300
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
35.300 35.300 35.300
Sewalem, A. et al . 2002 (A): 1 Chicken
chromosome 1
41.900 41.900 41.900
Wageningen (A): 1 Chicken
chromosome 1
44.900 44.900 44.900
Wageningen (F): 1 Chicken
chromosome 1
44.000 44.000 44.000
Wageningen (M): 1 Chicken
chromosome 1
46.000 46.000 46.000


© The Roslin Institute 2007-2012, all rights reserved