This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005748


Marker Name:  MCW0007 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: AGCAAAGAAGTGTTCTCTGTTCAT
Primer: ACCCTGCAAACTGGAAGGGTCTCA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003765

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
178.370 178.370 178.370
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
65961966.000 65962114.500 65962263.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
63956548.000 63956696.500 63956845.000


© The Roslin Institute 2007-2012, all rights reserved