This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005702


Marker Name:  LEI0232 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: TCAAGACAGATTCAAAACTCCA
Primer: CATAATTTCAAAGCTCAAAGCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: Z83786

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
524.240 524.240 524.240


© The Roslin Institute 2007-2012, all rights reserved