This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005697


Marker Name:  LEI0221 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CCTTTATCCACTCTTCATGCAC
Primer: TGCATAAATTCCATGGGTAAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: Z83791
has an Associated Sequence: Local Sequence ID: ARKFSQ00003743

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
472.610 472.610 472.610
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
147963842.000 147963943.000 147964044.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
142995375.000 142995476.000 142995577.000
Wageningen (A): 1 Chicken
chromosome 1
397.000 397.000 397.000
Wageningen (F): 1 Chicken
chromosome 1
382.800 382.800 382.800
Wageningen (M): 1 Chicken
chromosome 1
415.300 415.300 415.300


© The Roslin Institute 2007-2012, all rights reserved