This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005696


Marker Name:  LEI0217 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: GATGACTGAGAGAAATAACTTG
Primer: AAATTACTGAGGCACAGGAG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003742
has an Associated Sequence: Sequence Genbank ID: Z83796

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
302.930 302.930 302.930
East Lansing (M): 1 Chicken
chromosome 1
286.010 286.010 286.010
East Lansing (M): 1 Chicken
chromosome 1
0.000 0.000 0.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
99079318.000 99079430.500 99079543.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
95039576.000 95039688.500 95039801.000


© The Roslin Institute 2007-2012, all rights reserved