This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005684


Marker Name:  LEI0194 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TCCTTGGCATGTACATATGA
Primer: ACTGCATGTTCTTTGATAGGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: Z83779
has an Associated Sequence: Local Sequence ID: ARKFSQ00003729

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
81.000 81.000 81.000
Consensus 2005 (A): 1 Chicken
chromosome 1
80.000 81.000 82.000
East Lansing (M): 1 Chicken
chromosome 1
89.620 89.620 89.620
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
28787247.000 28787316.000 28787385.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
26919255.000 26919324.000 26919393.000
Wageningen (A): 1 Chicken
chromosome 1
51.100 51.100 51.100
Wageningen (F): 1 Chicken
chromosome 1
49.700 49.700 49.700
Wageningen (M): 1 Chicken
chromosome 1
55.100 55.100 55.100


© The Roslin Institute 2007-2012, all rights reserved