This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005683


Marker Name:  LEI0193 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: AGCTGGAGGTAGAATCCTGAA
Primer: ACAATCCCTTCCAACACACC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: Z83778
has an Associated Sequence: Local Sequence ID: ARKFSQ00003728

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
70.580 70.580 70.580
East Lansing (M): 1 Chicken
chromosome 1
112.730 112.730 112.730
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
41834092.000 41834240.000 41834388.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
39879578.000 39879726.000 39879874.000


© The Roslin Institute 2007-2012, all rights reserved