This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005670


Marker Name:  LEI0168 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ATCTAGATGACCCTTGAGGTC
Primer: GATCTGTGTTGTAGATATCTAAAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X85534
has an Associated Sequence: Local Sequence ID: ARKFSQ00003723

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
164898772.000 164898876.500 164898981.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
159967630.000 159967734.500 159967839.000
Wageningen (A): 1 Chicken
chromosome 1
428.300 428.300 428.300
Wageningen (F): 1 Chicken
chromosome 1
417.300 417.300 417.300
Wageningen (M): 1 Chicken
chromosome 1
448.100 448.100 448.100


© The Roslin Institute 2007-2012, all rights reserved