This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005663


Marker Name:  LEI0160 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CAAAGTAATCAGCTTGTGCTAC
Primer: CATTTCCACCGCATTGAGCAG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003721
has an Associated Sequence: Sequence Genbank ID: X85523

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
309.000 309.000 309.000
Consensus 2005 (A): 1 Chicken
chromosome 1
308.000 309.000 310.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
102460326.000 102460449.500 102460573.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
98383347.000 98383470.500 98383594.000
Wageningen (A): 1 Chicken
chromosome 1
279.500 279.500 279.500
Wageningen (F): 1 Chicken
chromosome 1
264.500 264.500 264.500
Wageningen (M): 1 Chicken
chromosome 1
296.700 296.700 296.700


© The Roslin Institute 2007-2012, all rights reserved