This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005656


Marker Name:  LEI0146 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TCAAGCCACCAAAGTGCTTGG
Primer: GATCACTCTGCTCATAGCAGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X83254
has an Associated Sequence: Local Sequence ID: ARKFSQ00003717

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
114.030 114.030 114.030
Consensus 2000 (A): 1 Chicken
chromosome 1
169.000 169.000 169.000
Consensus 2005 (A): 1 Chicken
chromosome 1
168.000 169.000 170.000
East Lansing (M): 1 Chicken
chromosome 1
150.100 150.100 150.100
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
55261640.000 55261765.000 55261890.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
53187445.000 53187570.000 53187695.000
Ikeobi, C.O.N. et al . 2004 (A): 1 Chicken
chromosome 1
125.600 125.600 125.600
Jacobsson et al 2004 (A): 1 Chicken
chromosome 1
136.000 136.000 136.000
Kerje et al. 2003a (A): 1 Chicken
chromosome 1
124.300 124.300 124.300
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
124.300 124.300 124.300
Sewalem, A. et al . 2002 (A): 1 Chicken
chromosome 1
125.600 125.600 125.600
Wageningen (A): 1 Chicken
chromosome 1
136.200 136.200 136.200
Wageningen (F): 1 Chicken
chromosome 1
124.600 124.600 124.600
Wageningen (M): 1 Chicken
chromosome 1
146.100 146.100 146.100


© The Roslin Institute 2007-2012, all rights reserved