This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005650


Marker Name:  LEI0139 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ACATTTGAGATGAAGCTTGCC
Primer: GGTATCTAGTGCATATGATGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X82872
has an Associated Sequence: Local Sequence ID: ARKFSQ00003712

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
130226543.000 130226671.500 130226800.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
125645589.000 125645717.500 125645846.000
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
337.400 337.400 337.400
Wageningen (A): 1 Chicken
chromosome 1
356.100 356.100 356.100
Wageningen (F): 1 Chicken
chromosome 1
334.300 334.300 334.300
Wageningen (M): 1 Chicken
chromosome 1
380.600 380.600 380.600


© The Roslin Institute 2007-2012, all rights reserved