This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005645


Marker Name:  LEI0134 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ACATTCAAGCCCTGACTCAGC
Primer: AATTTCCTGCACGTCCAGCTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003708
has an Associated Sequence: Sequence Genbank ID: X82858

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
527.000 527.000 527.000
Consensus 2005 (A): 1 Chicken
chromosome 1
526.000 527.000 528.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
191778894.000 191779042.000 191779190.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
186723781.000 186723929.000 186724077.000
Jacobsson et al 2004 (A): 1 Chicken
chromosome 1
523.600 523.600 523.600
Kerje et al. 2003a (A): 1 Chicken
chromosome 1
475.400 475.400 475.400
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
475.400 475.400 475.400
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
527.000 527.000 527.000
Wageningen (A): 1 Chicken
chromosome 1
504.900 504.900 504.900
Wageningen (F): 1 Chicken
chromosome 1
500.100 500.100 500.100
Wageningen (M): 1 Chicken
chromosome 1
524.200 524.200 524.200


© The Roslin Institute 2007-2012, all rights reserved