This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005639


Marker Name:  LEI0128 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TCTCCAGTAATACACATGGTG
Primer: CAAACTCAGAGCTAAGTCTAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X82806
has an Associated Sequence: Local Sequence ID: ARKFSQ00003707

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
305.000 305.000 305.000
Consensus 2005 (A): 1 Chicken
chromosome 1
304.000 305.000 306.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
102333846.000 102333976.500 102334107.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
98260071.000 98260201.500 98260332.000
Wageningen (A): 1 Chicken
chromosome 1
276.500 276.500 276.500
Wageningen (F): 1 Chicken
chromosome 1
261.800 261.800 261.800
Wageningen (M): 1 Chicken
chromosome 1
293.700 293.700 293.700


© The Roslin Institute 2007-2012, all rights reserved