This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005625


Marker Name:  LEI0114 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: TCTTTACCCACATCATTTGCCC
Primer: TTGCATGCTTCCTTCCAGGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X83247
has an Associated Sequence: Local Sequence ID: ARKFSQ00003702

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
90.810 90.810 90.810
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
50160554.000 50160677.500 50160801.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
48142067.000 48142190.500 48142314.000


© The Roslin Institute 2007-2012, all rights reserved