This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005622


Marker Name:  LEI0111 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 7910177

PCR Primers

Primer: CCCACAAAAGAGACACCGTGG
Primer: CCTGTTTGCCGTACACTTGGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003700
has an Associated Sequence: Local Sequence ID: ARKFSQ00003699
has an Associated Sequence: Sequence Genbank ID: X83241

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Ben-Avraham, D. et al 2006 (M): Z Chicken
chromosome Z
141.360 141.360 141.360
East Lansing (M): Z Chicken
chromosome Z
141.360 141.360 141.360
ENSEMBL53 WASHUC2 Chicken Assembly: Un_random Chicken
chromosome
11440818.000 11440856.500 11440895.000
ENSEMBL53 WASHUC2 Chicken Assembly: Z Chicken
chromosome Z
48390730.000 48390782.500 48390835.000
ENSEMBL71 Galgal4 Chick Assembly: Z Chicken
chromosome Z
49302565.000 49302617.500 49302670.000


© The Roslin Institute 2007-2012, all rights reserved