This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005619


Marker Name:  LEI0108 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: AGTTCAAGGTTGCAAGATGTG
Primer: TACATGCCATACTAGTCCTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X85517
has an Associated Sequence: Local Sequence ID: ARKFSQ00003696

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
300.000 300.000 300.000
Consensus 2005 (A): 1 Chicken
chromosome 1
299.000 300.000 301.000
East Lansing (M): 1 Chicken
chromosome 1
289.870 289.870 289.870
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
97147776.000 97147890.000 97148004.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
93132539.000 93132653.000 93132767.000
Jacobsson et al 2004 (A): 1 Chicken
chromosome 1
266.400 266.400 266.400
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
300.000 300.000 300.000
Wageningen (A): 1 Chicken
chromosome 1
270.800 270.800 270.800
Wageningen (F): 1 Chicken
chromosome 1
256.100 256.100 256.100
Wageningen (M): 1 Chicken
chromosome 1
288.000 288.000 288.000


© The Roslin Institute 2007-2012, all rights reserved