This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005618


Marker Name:  LEI0107 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ATCATTGCTACACCATGGTTC
Primer: GCTGCTCAGAAGCATCTGTGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003695
has an Associated Sequence: Sequence Genbank ID: X83253

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
424.000 424.000 424.000
Consensus 2005 (A): 1 Chicken
chromosome 1
423.000 424.000 425.000
East Lansing (M): 1 Chicken
chromosome 1
376.480 376.480 376.480
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
143677339.000 143677441.000 143677543.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
138754381.000 138754483.000 138754585.000
Jacobsson et al 2004 (A): 1 Chicken
chromosome 1
390.400 390.400 390.400
Kerje et al. 2003a (A): 1 Chicken
chromosome 1
372.300 372.300 372.300
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
372.300 372.300 372.300
Wageningen (A): 1 Chicken
chromosome 1
395.100 395.100 395.100
Wageningen (F): 1 Chicken
chromosome 1
381.800 381.800 381.800
Wageningen (M): 1 Chicken
chromosome 1
413.200 413.200 413.200


© The Roslin Institute 2007-2012, all rights reserved