This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005612


Marker Name:  LEI0101 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TGCAATCCAGCTTCAGTGGC
Primer: AGTCCTATCTTAGCCTGCTCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X82805
has an Associated Sequence: Local Sequence ID: ARKFSQ00003692

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
273.160 273.160 273.160
Consensus 2000 (A): 1 Chicken
chromosome 1
259.000 259.000 259.000
Consensus 2005 (A): 1 Chicken
chromosome 1
258.000 259.000 260.000
East Lansing (M): 1 Chicken
chromosome 1
236.480 236.480 236.480
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
84530979.000 84531115.500 84531252.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
80638372.000 80638508.500 80638645.000
Inglehearn, CF. et al . 2003 (A): 1 Chicken
chromosome 1
259.000 259.000 259.000
Kerje et al. 2003a (A): 1 Chicken
chromosome 1
209.300 209.300 209.300
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
209.300 209.300 209.300
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
259.000 259.000 259.000
Wageningen (A): 1 Chicken
chromosome 1
230.000 230.000 230.000
Wageningen (F): 1 Chicken
chromosome 1
218.100 218.100 218.100
Wageningen (M): 1 Chicken
chromosome 1
243.000 243.000 243.000
Yonash et al. 1999b (A): 1 Chicken
chromosome 1
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved