This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005608


Marker Name:  LEI0097 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TCCTCAGAGCATGAAGAAGCC
Primer: AGCCTGCAGACTTCAACCTTGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X83259
has an Associated Sequence: Local Sequence ID: ARKFSQ00003690

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
East Lansing (M): 6 Chicken
chromosome 6
58.510 58.510 58.510
ENSEMBL53 WASHUC2 Chicken Assembly: 6 Chicken
chromosome 6
20020426.000 20020536.500 20020647.000
ENSEMBL71 Galgal4 Chick Assembly: 6 Chicken
chromosome 6
18478743.000 18478853.500 18478964.000
Kerje, S et al. 2003 (A): 6 Chicken
chromosome 6
71.100 71.100 71.100
Wageningen (A): 6 Chicken
chromosome 6
74.800 74.800 74.800
Wageningen (F): 6 Chicken
chromosome 6
73.600 73.600 73.600
Wageningen (M): 6 Chicken
chromosome 6
72.800 72.800 72.800


© The Roslin Institute 2007-2012, all rights reserved