This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005602


Marker Name:  LEI0091 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TTCCCAAAACTCTTAAGTTGGAGG
Primer: ATCACCTTCATTAGACACTGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X83244

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
366.000 366.000 366.000
Consensus 2005 (A): 1 Chicken
chromosome 1
365.000 366.000 367.000
East Lansing (M): 1 Chicken
chromosome 1
330.950 330.950 330.950
Wageningen (A): 1 Chicken
chromosome 1
337.300 337.300 337.300
Wageningen (F): 1 Chicken
chromosome 1
315.900 315.900 315.900
Wageningen (M): 1 Chicken
chromosome 1
361.300 361.300 361.300


© The Roslin Institute 2007-2012, all rights reserved