This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005599


Marker Name:  LEI0088 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TGATTCACTTGATGGTCGAGG
Primer: GATCTAATGTGGAATGCCTGATGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X82816
has an Associated Sequence: Local Sequence ID: ARKFSQ00003683

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
321.330 321.330 321.330
Consensus 2000 (A): 1 Chicken
chromosome 1
316.000 316.000 316.000
Consensus 2005 (A): 1 Chicken
chromosome 1
315.000 316.000 317.000
East Lansing (M): 1 Chicken
chromosome 1
301.620 301.620 301.620
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
108492449.000 108492577.500 108492706.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
104434768.000 104434896.500 104435025.000
Kerje et al. 2003a (A): 1 Chicken
chromosome 1
258.800 258.800 258.800
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
258.800 258.800 258.800
Wageningen (A): 1 Chicken
chromosome 1
286.300 286.300 286.300
Wageningen (F): 1 Chicken
chromosome 1
268.700 268.700 268.700
Wageningen (M): 1 Chicken
chromosome 1
304.700 304.700 304.700


© The Roslin Institute 2007-2012, all rights reserved