This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005590


Marker Name:  LEI0079 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: ATCTCATTATCCTTGTGTGAAACTG
Primer: TCATTATCCTTGTGTGAAACTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X83242

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
509.410 509.410 509.410
East Lansing (M): 1 Chicken
chromosome 1
407.200 407.200 407.200
Wageningen (A): 1 Chicken
chromosome 1
413.300 413.300 413.300
Wageningen (F): 1 Chicken
chromosome 1
401.800 401.800 401.800
Wageningen (M): 1 Chicken
chromosome 1
433.500 433.500 433.500


© The Roslin Institute 2007-2012, all rights reserved