This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005586


Marker Name:  LEI0075 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TTTCACATCCAGTGCGTGTCTG
Primer: GGGCAGAGAAAGACGAAATGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003675
has an Associated Sequence: Sequence Genbank ID: X82794

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Ben-Avraham, D. et al 2006 (M): Z Chicken
chromosome Z
169.510 169.510 169.510
Consensus 2000 (A): Z Chicken
chromosome Z
165.000 165.000 165.000
Consensus 2005 (A): Z Chicken
chromosome Z
164.000 165.000 166.000
East Lansing (M): Z Chicken
chromosome Z
169.510 169.510 169.510
ENSEMBL53 WASHUC2 Chicken Assembly: Z Chicken
chromosome Z
60816403.000 60816482.500 60816562.000
ENSEMBL71 Galgal4 Chick Assembly: Z Chicken
chromosome Z
61986605.000 61986684.500 61986764.000
Ikeobi, C.O.N. et al . 2002 (A): Z Chicken
chromosome Z
150.000 150.000 150.000
Ikeobi, C.O.N. et al . 2004 (A): Z Chicken
chromosome Z
150.000 150.000 150.000
Kerje et al. 2003a (A): Z Chicken
chromosome Z
106.300 106.300 106.300
Kerje, S et al. 2003 (A): Z Chicken
chromosome Z
106.300 106.300 106.300
Sewalem, A. et al . 2002 (A): Z Chicken
chromosome Z
150.000 150.000 150.000
Wageningen (A): Z Chicken
chromosome Z
170.000 170.000 170.000
Wageningen (M): Z Chicken
chromosome Z
170.000 170.000 170.000


© The Roslin Institute 2007-2012, all rights reserved