This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005582


Marker Name:  LEI0071 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TCAGGTTAGTCTGACCATTGC
Primer: TGAGTGTAAGATTGCTAATGGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X82814
has an Associated Sequence: Local Sequence ID: ARKFSQ00003671

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
245.970 245.970 245.970
East Lansing (M): 1 Chicken
chromosome 1
211.160 211.160 211.160
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
79463238.000 79463387.500 79463537.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
75821542.000 75821691.500 75821841.000
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
189.700 189.700 189.700
Wageningen (A): 1 Chicken
chromosome 1
211.200 211.200 211.200
Wageningen (F): 1 Chicken
chromosome 1
200.000 200.000 200.000
Wageningen (M): 1 Chicken
chromosome 1
224.600 224.600 224.600


© The Roslin Institute 2007-2012, all rights reserved