This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005579


Marker Name:  LEI0068 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TCCTTCACTGGGCGTGCTC
Primer: CAAGTGTGAAGCCCATAGTGCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X82867
has an Associated Sequence: Local Sequence ID: ARKFSQ00003666

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
94.450 94.450 94.450
East Lansing (M): 1 Chicken
chromosome 1
140.320 140.320 140.320
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
51977627.000 51977737.000 51977847.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
49948861.000 49948971.000 49949081.000
Wageningen (A): 1 Chicken
chromosome 1
119.600 119.600 119.600
Wageningen (F): 1 Chicken
chromosome 1
110.200 110.200 110.200
Wageningen (M): 1 Chicken
chromosome 1
127.400 127.400 127.400


© The Roslin Institute 2007-2012, all rights reserved