This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005572


Marker Name:  LEI0061 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: TGCCTCTGACATTATGGGCC
Primer: GCTGGCAGTGTGTCTGACTAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X82791
has an Associated Sequence: Local Sequence ID: ARKFSQ00003659

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
594.390 594.390 594.390
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
187224335.000 187224451.500 187224568.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
182196400.000 182196516.500 182196633.000


© The Roslin Institute 2007-2012, all rights reserved