This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005560


Marker Name:  LAMP1 
Species:  Chicken
Marker Type:  OTHER-PCR-TYPES
Publication ID: 9598314

PCR Primers

Primer: GTTGAGTGAGAGGAGCGAGG
Primer: TGTCATTCGATGCTTCAA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
470.760 470.760 470.760
Consensus 2000 (A): 1 Chicken
chromosome 1
418.000 418.000 418.000
East Lansing (M): 1 Chicken
chromosome 1
370.690 370.690 370.690
Wageningen (A): 1 Chicken
chromosome 1
389.100 389.100 389.100
Wageningen (F): 1 Chicken
chromosome 1
374.400 374.400 374.400
Wageningen (M): 1 Chicken
chromosome 1
408.300 408.300 408.300


© The Roslin Institute 2007-2012, all rights reserved