This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005443


Marker Name:  HUJ0003 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GACAGCAAGGATTAACCTGAC
Primer: GTCTTGGAGACTGTTAGTTGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L05590
has an Associated Sequence: Local Sequence ID: ARKFSQ00003650

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
109.000 109.000 109.000
Consensus 2005 (A): 1 Chicken
chromosome 1
108.000 109.000 110.000
East Lansing (M): 1 Chicken
chromosome 1
102.600 102.600 102.600
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
37329092.000 37329164.000 37329236.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
35413514.000 35413586.000 35413658.000
Wageningen (A): 1 Chicken
chromosome 1
75.900 75.900 75.900
Wageningen (F): 1 Chicken
chromosome 1
68.300 68.300 68.300
Wageningen (M): 1 Chicken
chromosome 1
81.900 81.900 81.900


© The Roslin Institute 2007-2012, all rights reserved