This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005441


Marker Name:  HUJ0001 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CCCTTTGTTAACACCTACTGAC
Primer: CCCTTTGTTAACACCTACTGCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L05542

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
54.000 54.000 54.000
Consensus 2005 (A): 1 Chicken
chromosome 1
53.000 54.000 55.000
East Lansing (M): 1 Chicken
chromosome 1
48.460 48.460 48.460
Jennen et al. 2004 (A): 1 Chicken
chromosome 1
54.000 54.000 54.000
Wageningen (A): 1 Chicken
chromosome 1
30.400 30.400 30.400
Wageningen (F): 1 Chicken
chromosome 1
31.100 31.100 31.100
Wageningen (M): 1 Chicken
chromosome 1
28.100 28.100 28.100


© The Roslin Institute 2007-2012, all rights reserved