This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005417


Marker Name:  HA 
Species:  Chicken
Marker Type:  Sequencing
Publication ID: 9598314

PCR Primers

Primer: ACAGTGAGCTCCATGCCTG
Primer: CCGCATTGTCTGAGTTAAAGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003647

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
143.000 143.000 143.000
East Lansing (M): 1 Chicken
chromosome 1
130.390 130.390 130.390
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
49977862.000 49978008.000 49978154.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
47960657.000 47960803.000 47960949.000
Wageningen (A): 1 Chicken
chromosome 1
107.700 107.700 107.700
Wageningen (F): 1 Chicken
chromosome 1
99.000 99.000 99.000
Wageningen (M): 1 Chicken
chromosome 1
115.100 115.100 115.100


© The Roslin Institute 2007-2012, all rights reserved