This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005373


Marker Name:  GCT0055 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: GAACATGGGCAATGCTCTTT
Primer: TGTGTTCCTCTCCATGCGTA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AJ012247
has an Associated Sequence: Local Sequence ID: ARKFSQ00003639

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
0.000 0.000 0.000
East Lansing (M): 12 Chicken
chromosome 12
0.000 0.000 0.000
ENSEMBL53 WASHUC2 Chicken Assembly: 12 Chicken
chromosome 12
11106924.000 11107024.000 11107124.000
ENSEMBL71 Galgal4 Chick Assembly: 12 Chicken
chromosome 12
10803952.000 10804052.000 10804152.000


© The Roslin Institute 2007-2012, all rights reserved