This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005342


Marker Name:  GCT0024 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: CATTGCTTGGATGTTGGATG
Primer: CTCCTATGTTCCATTGGTTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AJ233972
has an Associated Sequence: Local Sequence ID: ARKFSQ00003627

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
493.240 493.240 493.240
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
154869711.000 154869826.000 154869941.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
149856201.000 149856316.000 149856431.000


© The Roslin Institute 2007-2012, all rights reserved