This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00005274


Marker Name:  FASN 
Species:  Chicken
Marker Type:  SSCP
Publication ID: 1353476

PCR Primers

Primer: TCAGAAGGGTGGAAGTGAG
Primer: AGGTCTCCTCTGTATCATAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: J02839
has an Associated Sequence: Local Sequence ID: ARKFSQ00003607

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 18 Chicken
chromosome 18
0.000 0.000 0.000
East Lansing (M): 18 Chicken
chromosome 18
93.470 93.470 93.470
ENSEMBL53 WASHUC2 Chicken Assembly: 18 Chicken
chromosome 18
4941194.000 4941506.500 4941819.000
ENSEMBL71 Galgal4 Chick Assembly: 18 Chicken
chromosome 18
4919863.000 4920175.500 4920488.000


© The Roslin Institute 2007-2012, all rights reserved