This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004954


Marker Name:  ALDOB 
Species:  Chicken
Marker Type:  RFLP
Publication ID: 7910177

PCR Primers

Primer: AGTCTTACCTGATGGTGACC
Primer: TTGTAGACAGCAGCCAGAAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003593

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Ben-Avraham, D. et al 2006 (M): Z Chicken
chromosome Z
165.420 165.420 165.420
East Lansing (M): Z Chicken
chromosome Z
165.420 165.420 165.420
ENSEMBL53 WASHUC2 Chicken Assembly: Z Chicken
chromosome Z
63706747.000 63707024.500 63707302.000
ENSEMBL71 Galgal4 Chick Assembly: Z Chicken
chromosome Z
64955902.000 64956179.500 64956457.000


© The Roslin Institute 2007-2012, all rights reserved