This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004856


Marker Name:  ADL0328 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CACCCATAGCTGTGACTTTG
Primer: AAAACCGGAATGTGTAACTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G16094
has an Associated Sequence: Local Sequence ID: ARKFSQ00003578

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
East Lansing (M): 1 Chicken
chromosome 1
443.060 443.060 443.060
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
173442693.000 173442750.000 173442807.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
168442739.000 168442796.000 168442853.000
Kerje, S et al. 2003 (A): 1 Chicken
chromosome 1
425.900 425.900 425.900
Wageningen (A): 1 Chicken
chromosome 1
448.200 448.200 448.200
Wageningen (F): 1 Chicken
chromosome 1
428.600 428.600 428.600
Wageningen (M): 1 Chicken
chromosome 1
476.800 476.800 476.800


© The Roslin Institute 2007-2012, all rights reserved