This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004842


Marker Name:  ADL0314 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CCCCATAATTCTTTCAGTGC
Primer: CATCCAATGCAGACAGGACA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003567
has an Associated Sequence: Sequence Genbank ID: G16083

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
281.000 281.000 281.000
Consensus 2005 (A): 1 Chicken
chromosome 1
411.000 416.000 421.000
East Lansing (M): 1 Chicken
chromosome 1
258.060 258.060 258.060
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
90354029.000 90354117.500 90354206.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
86398057.000 86398145.500 86398234.000
Wageningen (A): 1 Chicken
chromosome 1
254.800 254.800 254.800
Wageningen (F): 1 Chicken
chromosome 1
244.500 244.500 244.500
Wageningen (M): 1 Chicken
chromosome 1
266.700 266.700 266.700


© The Roslin Institute 2007-2012, all rights reserved