This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004835


Marker Name:  ADL0307 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GCTGCTTAACTAAATGTTTG
Primer: CAAGCGNCACTGACCCTGTC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003561
has an Associated Sequence: Sequence Genbank ID: G01752

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
128.000 128.000 128.000
Consensus 2005 (A): 1 Chicken
chromosome 1
127.000 128.000 129.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
47367912.000 47368018.500 47368125.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
45340710.000 45340816.500 45340923.000
Tilquin et al. 2005 (A): 1 Chicken
chromosome 1
128.000 128.000 128.000
Wageningen (A): 1 Chicken
chromosome 1
94.600 94.600 94.600
Wageningen (F): 1 Chicken
chromosome 1
85.200 85.200 85.200
Wageningen (M): 1 Chicken
chromosome 1
101.700 101.700 101.700


© The Roslin Institute 2007-2012, all rights reserved