This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004819


Marker Name:  ADL0292 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CCAAATCAGGCAAAACTTCT
Primer: AAATGGCCTAAGGATGAGGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01710
has an Associated Sequence: Local Sequence ID: ARKFSQ00003552

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 5 Chicken
chromosome 5
83.000 83.000 83.000
Consensus 2005 (A): 5 Chicken
chromosome 5
82.000 83.000 84.000
East Lansing (M): 5 Chicken
chromosome 5
80.650 80.650 80.650
ENSEMBL53 WASHUC2 Chicken Assembly: 5 Chicken
chromosome 5
28525691.000 28525754.500 28525818.000
ENSEMBL71 Galgal4 Chick Assembly: 5 Chicken
chromosome 5
25639133.000 25639196.500 25639260.000
Ikeobi, C.O.N. et al . 2002 (A): 5 Chicken
chromosome 5
51.000 51.000 51.000
Ikeobi, C.O.N. et al . 2004 (A): 5 Chicken
chromosome 5
51.000 51.000 51.000
Wageningen (A): 5 Chicken
chromosome 5
59.000 59.000 59.000
Wageningen (F): 5 Chicken
chromosome 5
64.400 64.400 64.400
Wageningen (M): 5 Chicken
chromosome 5
51.900 51.900 51.900


© The Roslin Institute 2007-2012, all rights reserved