This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004817


Marker Name:  ADL0290 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: AAAGGCCAGGATGGATTTTC
Primer: CCCACCGGTCAGCACGAAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01748
has an Associated Sequence: Local Sequence ID: ARKFSQ00003551

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Carlborg, Orjan. et al . 2003 (A): 18 Chicken
chromosome 18
0.000 0.000 0.000
Consensus 2000 (A): 18 Chicken
chromosome 18
35.000 35.000 35.000
Consensus 2005 (A): 18 Chicken
chromosome 18
34.000 35.000 36.000
East Lansing (M): 18 Chicken
chromosome 18
91.550 91.550 91.550
ENSEMBL53 WASHUC2 Chicken Assembly: 18 Chicken
chromosome 18
4653744.000 4653837.500 4653931.000
ENSEMBL71 Galgal4 Chick Assembly: 18 Chicken
chromosome 18
4636697.000 4636790.500 4636884.000
Jennen et al. 2005 (A): 18 Chicken
chromosome 18
36.700 36.700 36.700
Kerje et al. 2003a (A): 18 Chicken
chromosome 18
0.000 0.000 0.000
Kerje, S et al. 2003 (A): 18 Chicken
chromosome 18
0.000 0.000 0.000
Wageningen (A): 18 Chicken
chromosome 18
36.400 36.400 36.400
Wageningen (F): 18 Chicken
chromosome 18
35.700 35.700 35.700
Wageningen (M): 18 Chicken
chromosome 18
38.600 38.600 38.600


© The Roslin Institute 2007-2012, all rights reserved