This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004795


Marker Name:  ADL0268 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CTCCACCCCTCTCAGAACTA
Primer: CAACTTCCCATCTACCTACT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01688
has an Associated Sequence: Local Sequence ID: ARKFSQ00003539

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
288.000 288.000 288.000
Consensus 2005 (A): 1 Chicken
chromosome 1
287.000 288.000 289.000
East Lansing (M): 1 Chicken
chromosome 1
270.100 270.100 270.100
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
92255503.000 92255558.500 92255614.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
88347625.000 88347680.500 88347736.000
Wageningen (A): 1 Chicken
chromosome 1
258.700 258.700 258.700
Wageningen (F): 1 Chicken
chromosome 1
248.100 248.100 248.100
Wageningen (M): 1 Chicken
chromosome 1
272.000 272.000 272.000
Yonash et al. 1999b (A): 1 Chicken
chromosome 1
34.000 34.000 34.000


© The Roslin Institute 2007-2012, all rights reserved