This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004786


Marker Name:  ADL0259 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GTAATGGAGGATGCTCAGGT
Primer: CTCATTGCAGAGGAAGTTCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01679
has an Associated Sequence: Local Sequence ID: ARKFSQ00003530

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 9 Chicken
chromosome 9
122.000 122.000 122.000
Consensus 2005 (A): 9 Chicken
chromosome 9
121.000 122.000 123.000
ENSEMBL53 WASHUC2 Chicken Assembly: 9 Chicken
chromosome 9
22555353.000 22555408.500 22555464.000
ENSEMBL71 Galgal4 Chick Assembly: 9 Chicken
chromosome 9
20471407.000 20471462.500 20471518.000
Wageningen (A): 9 Chicken
chromosome 9
92.300 92.300 92.300
Wageningen (F): 9 Chicken
chromosome 9
94.100 94.100 94.100
Wageningen (M): 9 Chicken
chromosome 9
90.900 90.900 90.900


© The Roslin Institute 2007-2012, all rights reserved