This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004778


Marker Name:  ADL0251 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: TTTGGCTTAGGGTGATGCTG
Primer: CGTGCTCCACACAGGAATGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01671
has an Associated Sequence: Local Sequence ID: ARKFSQ00003522

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 1 Chicken
chromosome 1
267.000 267.000 267.000
Consensus 2005 (A): 1 Chicken
chromosome 1
266.000 267.000 268.000
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
86686388.000 86686449.500 86686511.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
82761379.000 82761440.500 82761502.000
Wageningen (A): 1 Chicken
chromosome 1
239.100 239.100 239.100
Wageningen (F): 1 Chicken
chromosome 1
231.400 231.400 231.400
Wageningen (M): 1 Chicken
chromosome 1
250.900 250.900 250.900


© The Roslin Institute 2007-2012, all rights reserved