This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004772


Marker Name:  ADL0245 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 1353476

PCR Primers

Primer: ACAAGGGTGGTGCTTAGTCC
Primer: AAGTGAAACCAGGAAACGAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01665
has an Associated Sequence: Local Sequence ID: ARKFSQ00003517

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
532.480 532.480 532.480
East Lansing (M): 1 Chicken
chromosome 1
439.180 439.180 439.180
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
171731178.000 171731232.500 171731287.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
166752367.000 166752421.500 166752476.000


© The Roslin Institute 2007-2012, all rights reserved