This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004765


Marker Name:  ADL0238 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: AAACCCAAACAAAAGCAGAC
Primer: GCTCCTCATAAGCAAAATGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01658
has an Associated Sequence: Local Sequence ID: ARKFSQ00003513

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
186380906.000 186380985.500 186381065.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
181293151.000 181293230.500 181293310.000
Wageningen (A): 1 Chicken
chromosome 1
496.900 496.900 496.900
Wageningen (F): 1 Chicken
chromosome 1
490.200 490.200 490.200
Wageningen (M): 1 Chicken
chromosome 1
516.000 516.000 516.000


© The Roslin Institute 2007-2012, all rights reserved