This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004764


Marker Name:  ADL0237 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GCTTGTGCCTAAGAATGAAC
Primer: TGTATGGAGTCTCAGCAAAT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003512
has an Associated Sequence: Sequence Genbank ID: G01657

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 3 Chicken
chromosome 3
266.810 266.810 266.810
Consensus 2000 (A): 3 Chicken
chromosome 3
275.000 275.000 275.000
Consensus 2005 (A): 3 Chicken
chromosome 3
274.000 275.000 276.000
East Lansing (M): 3 Chicken
chromosome 3
287.640 287.640 287.640
ENSEMBL53 WASHUC2 Chicken Assembly: 3 Chicken
chromosome 3
103804764.000 103804833.000 103804902.000
ENSEMBL71 Galgal4 Chick Assembly: 3 Chicken
chromosome 3
100573981.000 100574050.000 100574119.000
Kerje et al. 2003a (A): 3 Chicken
chromosome 3
273.400 273.400 273.400
Kerje, S et al. 2003 (A): 3 Chicken
chromosome 3
273.400 273.400 273.400
Wageningen (A): 3 Chicken
chromosome 3
276.300 276.300 276.300
Wageningen (F): 3 Chicken
chromosome 3
261.700 261.700 261.700
Wageningen (M): 3 Chicken
chromosome 3
288.800 288.800 288.800


© The Roslin Institute 2007-2012, all rights reserved