This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004761


Marker Name:  ADL0234 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: CCCTGGGGCTCCCTCAGCAC
Primer: CTGGACGCGTGAAAAAGTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G01654
has an Associated Sequence: Local Sequence ID: ARKFSQ00003508

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Compton (F): 1 Chicken
chromosome 1
94.450 94.450 94.450
Consensus 2000 (A): 1 Chicken
chromosome 1
151.000 151.000 151.000
Consensus 2005 (A): 1 Chicken
chromosome 1
150.000 151.000 152.000
East Lansing (M): 1 Chicken
chromosome 1
140.320 140.320 140.320
ENSEMBL53 WASHUC2 Chicken Assembly: 1 Chicken
chromosome 1
51794555.000 51794634.500 51794714.000
ENSEMBL71 Galgal4 Chick Assembly: 1 Chicken
chromosome 1
49764413.000 49764492.500 49764572.000
Wageningen (A): 1 Chicken
chromosome 1
119.600 119.600 119.600
Wageningen (F): 1 Chicken
chromosome 1
110.200 110.200 110.200
Wageningen (M): 1 Chicken
chromosome 1
127.400 127.400 127.400


© The Roslin Institute 2007-2012, all rights reserved